EXPERIMENT RECORD N° 9451
EXPOSE-R2 - P.S.S. - Photochemistry on the Space Station
  1. 2014 • EXPOSE-R2
  2. 2014 • ISS Increments 39-40
  3. 2014 • ISS Increments 41-42
  4. 2015 • ISS Increments 43-44
  5. 2015 • ISS Increments 45-46
Life Sciences:
  • Exobiology
Rene Demets
rene.demets@esa.int
H. Cottin (1), F. Westall (2), P. Ehrenfreund (6), A. Mattioda (7), A. Ricco (7), A. Le Postollec (7), C. Szopa (3), G. Coussot (7), G. Baratta (7), M. Bertrand (2), M. Dobrijevic (4), N. Fray (7), O. Vandenabeele-Trambouze (5), O. Santos (7), R. Quinn (7), S. Incerti (7), E. Peyrin (7), F. Raulin (7), G. Strazzula (7), P. Coll (1), P. Moretto (7)
(1)  
Laboratoire Interuniversitaire des Systèmes Atmosphériques - LISA
Université Paris-Est Créteil & Université Paris Diderot
CNRS UMR 7583
61, avenue du Général de Gaulle
94010 Creteil Cedex
FRANCE
Tel:  
+33(0)145.17.15.63
Fax:  
+33(0)145.17.15.64
e-mail:  
herve.cottin@lisa.u-pec.fr
patrice.coll@lisa.u-pec.fr
(2)  
CNRS - Centre de Biophysique Moléculaire
rue Charles Sadron
45071 Orléans Cedex 2
FRANCE
e-mail:  
Westall@cnrs-orleans.fr
marylene.bertrand@cnrs-orleans.fr
(3)  
UPMC Université Paris 06
Université de Versailles Saint-Quentin
CNRS/INSU
LATMOS-IPSL
Paris
FRANCE
(4)  
Observatoire de Bordeaux
B.P. 89
33270 Floriac
FRANCE
Tel:  
+33557776124
Fax:  
+33557776110
e-mail:  
michel@observ.u-bordeaux.fr
(5)  
Université de Montpelier
Montpelier
FRANCE
(6)  
Leiden Institute of Chemistry
Astrobiology Laboratory
P.O. Box 9502
2300 RA Leiden
THE NETHERLANDS
Tel:  
+31(0)715274541
Fax:  
+31(0)715274397
e-mail:  
p.ehrenfreund@chem.leidenuniv.nl

General scientific background:
Three ESA experiments have been selected for the Expose-R2 mission: BIOMEX, BOSS and P.S.S. Each experiment requires test samples to be exposed to the open space environment, i.e. a combination of full-spectrum electromagnetic radiation from the Sun, cosmic particle radiation, vacuum, temperature fluctuations and microgravity. BIOMEX, BOSS and P.S.S. are follow-on studies to earlier astrobiology experiments carried out by ESA on BIOPAN and EXPOSE, and on other space missions. As before, the sun-exposed samples will be accompanied in-flight by reference samples which are maintained in darkness (with the remaining space factors identical to the sun-exposed samples). In addition, a control experiment will be conducted on ground.

OBJECTIVE
BIOMEX, BOSS and P.S.S. are astrobiology studies aimed at identifying and quantifying damage suffered by biological and biochemical test samples during exposure to the harsh space environment.

Sample Materials:
The sample materials are either
- Biologically alive but dormant (BIOMEX, BOSS), or
- Lifeless, consisting of chemical compounds (P.S.S.), biochips (P.S.S.), minerals and pigments (BIOMEX, BOSS).

SPECIFIC OBJECTIVES
Solar ultraviolet photons are a major source of energy to initiate chemical reactions in the solar system. Many experimental programs on Earth are devoted to photochemical studies of the evolution of organic molecules. However, the solar spectrum below 200 nm is hard to reproduce in the laboratory, therefore the validity of these on-Earth studies and their applications to extraterrestrial environments can be questioned as long as experiments conducted in a genuine space environment have not been carried out. Such studies are mandatory for understanding the chemical evolution in organic-rich astrophysical environments (comets, meteorites, Titan, interstellar medium) and where organic matter is being looked for (Martian surface and subsurface). In P.S.S., a wide range of organic compounds will be tested. In addition, some biochips will be tested for survival during space travel. The latter are foreseen to be used during future exploration missions, for instance to detect specific organic compounds on Mars.

The sample materials used in P.S.S. are not hazardous at the used concentration level and
quantity:
  • Carbon 60, C60
  • Carbon 70, C70
  • Isoviolanthren,C34H18
  • Isoviolanthrone (C34,H16O2)
  • Dicoronylene (C48H20)
  • Periflanthene (C32H16)
  •
Quaterrylene (C40H20)
  • Terrylene(C20H12)
  • Iron tetraphenyl porphyrin chloride
  • Trypthophan (C11H12N2O2)
  • Anthrarufin (C2H4O2)
  • Porphyrin (C20H14N4)
  • Residues of laboratory irradiated ices mixtures (3 thicknesses)
  • HCN polymer
  • Glycine
  • Adenine
  • Guanine
  • Uracile
  • Thymine
  • Isocytosine
  • 4-aminopyrimidine
  • Imidazole
  • Gly Gly, cyclo(Gly Gly), Ala Ala, Phe Phe, Asp Asp, Cyclo(Ala Ala) and cyclo(Asp Asp)
  • 98% N2 – 2% CH4 (100 mbar)
  • 98% He – 2% CH4 (100 mbar)
  • Low T Tholins and Room T Tholins
  • Diploptene
  • Diploterol
  • pentanoic acid (CH3-(CH2)3-COOH)
  • glutaric acid (COOH-(CH2)3-COOH)
  • 2-hydroxypentanoic acid
  • Nonanoic acid
  • Stearic acid
  • Oleic acid
  • Glucose
  • Mannose
  • Anthracene
  • Phenanthrene
  • Naphtalene
  • Pristane
  • Phytane
  • Squalane
  • Carotene
  • Biotic calcite
  • Aragonite
  • Hydromagnesite
  • Free Antibodies
  • Antibodies Fixed on a substrate
  • Fluorescent dye (FITC)
  • N2O, CO2
  • HOPG (High Ordered Pyrolitic Graphite)
  • Blank MgF2 window
  • Blank quartz window
  • Biochips (DNA aptamers)
     o BSA
     o Acid citric
     o L-Histidine
     o D-Arginine
     o Tween 20
     o Sucrose
     o Aptamers sequence 5´-
     o AATTCGCTAGCTGGAGCTTGGATTGATGTGGTGTGTGAGTGCGGTGCCC-Fluoresceine-/3´ /
     o Antibodies
     o NaOH
     o Fluorescein
     o Polypropylene
  • Meteoritic Powder (carbonaceous type)

Previous flight experiments:
DUST 1  - Stability and processing of amino acids and peptides in artificial dust grains in space
1994 - Biopan-1 on Foton-9

DUST 2 - Stability and processing of amino acids and peptides in artificial dust grains in space
1997 - Biopan-2 on Foton-11

PERSEUS-Exobiology
MIR´ 99

ORGANICS 2 - Extraterrestrial delivery of organic molecules
2005 - Biopan 5 on Foton-M2

UV-OLUTION
2007 - Biopan 6 on Foton-M3

PROCESS - PRebiotic Organic ChEmistry on Space Station
2008 - Expose-E on ISS-EuTEF

ORGANIC - Evolution of organic matter in space
2009 - Expose-R on ISS-Zvezda 

AMINO - Photochemical processing of amino acids and other organic compounds in Earth orbit
2009 - Expose-R on ISS-Zvezda

Justification for the need of space experiment:
The required space conditions can only partially be simulated on ground – and then separately, not in combination. Full-spectrum solar irradiation can only be approximated (not duplicated) in the lab and only for limited periods of time. Neither can cosmic particle radiation faithfully be simulated on Earth.

EXPOSE-R2 launched aboard Progress M-24M on 23 July 2014. Russian cosmonauts Alexander Skvortsov and Oleg Artemyev (Expedition 40) installed EXPOSE-R2 on 18 August 2014 during Expedition40/EVA2 (Russian EVA-39). The payload will remain installed on URM-D II for up to 18 months.

On 22 October 2014 - during Russian EVA-40, ISS Commander Maksim Suraev and Flight Engineer Alexander Samokutyaev (Expedition 41) released a protective cover from the EXPOSE-R2 payload that was installed on the Plane II URM-D by Oleg Artemyev and Aleksandr Skvortsov on the previous Russian spacewalk back in August. With its cover removed, EXPOSE-R2 was set for long-duration exposure to the space environment outside the Station in Low Earth Orbit to study the effects of the environment on different materials and organisms.

On 3 February 2016, the EXPOSE-R2 facility was retrieved from outside the ISS by Russian cosmonauts Yuri Malenchenko and Sergei Volkov. The P.S.S. samples returned to Earth for analysis on board of Soyuz spacecraft 44S on 2 March 2016. While the experiment containers with BIOMEX, BOSS and BIODIVERSITY samples returned from the ISS to Earth on 18 June 2016, at 09:15 h GMT, in the Soyuz TMA-19M spacecraft with ESA astronaut Tim Peake.

SAMPLE CARRIERS
During the EXPOSE-R2 mission the core facility of EXPOSE-R will be used again, but equipped with new trays and sample carriers. Each of the three ESA experiments (BIOMEX, BOSS and P.S.S.) will occupy three carriers. Two carriers have been allocated to a guest experiment from IBMP. One carrier compartment will be occupied by an active sensor package (as has been the case for EXPOSE-E and -R).

BIOMEX: 3 carriers
BOSS: 3 carriers
P.S.S.: 3 carriers
IBMP:  2 carriers
active sensors: 1 carrier
total:  12 carriers

The sample carriers shall be of the same type as used before on EXPOSE-E and -R, with the following exceptions (see Table 1):
- P.S.S. requires a higher number of sample positions per carrier (present density: 20 sample cells per carrier).
- The PD (Payload Developer) shall avoid or minimize utilization of all materials/processes which may lead to contamination by outgassing inside the sample carriers.
- A ground simulation activity shall be conducted to measure the rate of transmission loss due to internal contamination of the sample carriers.
- To obtain a larger FOV (some of) the BOSS samples shall be placed more closely to the windows than was the case on EXPOSE-E and -R. If this is accomplished by raising the sample seats (for instance by introducing plugs underneath) there is no need to change the design of the carrier.

OPTICAL FILTERS and GLASSWARE
Neutral density filters
(MgF2 and quartz) are required for wavelength-independent attenuation of solar radiation.
Long-pass cut-off filters are required for simulation of the Martian UV wavelength spectrum (similar as used on EXPOSE-E).

A TBD amount of quartz sample discs („sample seats‟) are necessary to accommodate the test samples.
The amount, size and properties of the above mentioned HW parts, as well as their distribution over the carriers, will depend on the outcome of pre-flight ground tests.

ACTIVE SENSORS
As was the case on EXPOSE-E and -R, one carrier compartment shall contain electrically active sensors. The R3D package as flown on -E and -R shall be maintained. The shielding density in front of the particle detector of R3D (now 0.4 g/cm2) shall be decreased to 0.31 g/cm2 to match the shielding density in front of the minimally-shielded samples from P.S.S.

R3D package
The R3D (Radiation Risks Radiometer-Dosimeter) is a low-mass, low-size automatic device which measures - with time resolution - the solar irradiance over four wavelength ranges. In addition, it can measure the fluence of cosmic particles. The R3D is equipped with a flash memory of 256 MB, capable to store more than 500 days of data. In addition, the measured data can be down-linked by telemetry.

The solar irradiance is measured over four wavelength ranges:
- UV-C (170-280 nm)
- UV-B (280-315 nm)
- UV-A (315-400 nm)
- PAR (= photosynthetic active radiation, 400-700 nm).

The four solar sensors are placed behind circular windows (diameter: 9 mm). The temperature of R3D is monitored by an in-built thermometer.

The energy deposited by the incoming cosmic particles is measured in a 256-channel spectrometer equipped with a silicon detector (surface area: 2 cm2, thickness: 0.3 mm).

The detector of R3D instrument is shielded by less than 0.4 g/cm2 material including: 1 mm aluminum + 0.1 mm copper + 0.2 mm plastic. This allows the detection of electrons with energies higher than 0.78 MeV and protons with energies higher than 15.8 MeV.

The time resolution (1 data point per 10 sec) allows the detection of short-term variations in the particle radiation environment within every orbital loop. The analysis of the spectra provides the history of the accumulation of the radiation dose in μGy/h, the total dose in Gy, the particle flux in particles/cm2/s and the fluence of particles with different deposition energies.

PASSIVE RADIATION DOSIMETRY
The carriers of BOSS, BIOMEX and IBMP shall be configured to accommodate depthdose stacks (cf. EXPOSE-E) while the trays shall be fitted with pockets to accommodate passive detectors underneath the carriers (cf. EXPOSE-E).

In addition, EXPOSE-R2 shall carry passive detectors to measure the low-shielding radiation environment of the sun-exposed P.S.S. samples. (Some) sample cells of P.S.S. shall be configured in such a way that TLD chips can be accommodated directly behind the P.S.S. quartz windows (shielding: 0.31 g/cm2 in the top layer).

In parallel to the flight experiment, a mission ground reference (MGR) experiment shall be conducted. In the MGR the environmental history of the flight samples will be simulated as far as technically feasible, except for cosmic radiation and microgravity. As such, the results from the MGR will aid to interpret the results stemming from the flight experiment. A flight-identical set of sample carriers and trays is required for the MGR. For the MGR the sample carriers from the SVT (Science Verification Test) will be used.

Pre- and post-flight analysis
ORGANIC AND MINERAL COMPOUNDS
Before launch and after retrieval, the P.S.S. samples will be measured by UVVis, Raman and IR spectroscopy. The photochemical reactivity of these compounds will be determined and the kinetic details of photochemical degradation will be analyzed. In addition, high-performance liquid chromatography (HPLC) will be performed and/or gas chromatography-mass spectroscopy (GC-MS) analysis of all the samples after retrieval, comparing the UV-exposed and ground control samples in order to identify photo-products and fragments that cannot be unambiguously determined via optical spectroscopy.

Additional laboratory experiments will include ground control sample exposure to a solar simulator or UV H2-discharge lamp illumination to provide shortwavelength, high-energy UV radiation that simulates interplanetary and interstellar conditions, respectively.

After processing of the measurements, we will be able to calculate the photochemical lifetime of the molecule at 1 AU, which can subsequently be extrapolated at other heliocentric distances and other astrophysical environments (diffuse interstellar medium, dark clouds).

BIOCHIP
Pre-flight: study of antibody and aptamer recognition capabilities for laboratory reference samples. All samples will be freeze-dried. Some samples will contain antibodies fixed on a substrate (covalent link) and free antibodies.

Post-flight: study of antibody and aptamer recognition capabilites. Study of fluorescent dies degradation.

Short description of analytical steps:
 (i) put target molecules in contact with antibodies (or aptamers),
 (ii) detection by fluorescence of recognition events,
 (iii) comparison with reference samples and ground reference samples,
 (iv) determination of recognition loss to irradiations and other space constraints.

ADDITIONAL STUDIES
Pre-flight: Monte-Carlo simulations to predict cosmic-rays fluences in cells.

Post-flight: Irradiation experiments on beam line facilities in case of samples degradation (if there are suspected to be due to cosmic-rays).

RESULTS
The PSS experiment is a follow-up of the PROCESS (Cottin et al., The PROCESS experiment: an astrochemistry laboratory for solid and gaseous organic samples in low Earth orbit. Astrobiology. 2012) and AMINO (Cottin et al., The AMINO experiment: a laboratory for astrochemistry and astrobiology on the EXPOSE-R facility of the International Space Station. International Journal of Astrobiology. 2015) experiments conducted on EXPOSE-E and EXPOSE-R, respectively, with an improved hardware that allows for better simulation of the martian environment as well as the exposure of aptamers and antibodies, which will help prepare future generations of biochip-based space instruments (Cottin et al., Photochemical studies in low Earth orbit for organic compounds related to small bodies, Titan and Mars. Current and Future Facilities, Bulletin de la Société Royale des Sciences de Liège. 2015).

Baratta et al. (2019 - Reference Documents no. 21) report on the evolution of organic samples prepared by 200 keV He+ irradiation of N2:CH4:CO icy mixtures deposited at 17 K, on vacuum UV transparent MgF2 windows. Such material made by irradiation of ice mixtures could be present in interstellar clouds or comets, from which they could be expelled on dust particles and reach Earth as interplanetary dust particles (IDPs).
Results show that the nitriles and amines moieties contained in relatively large IDPs (>20-30 mm) could have survived in the interplanetary medium; hence they could have reached prebiotic Earth.

Stalport et al. (2019 - Reference Documents no. 24) report on the stability of organic compounds in the martian environment: chrysene, adenine, and glycine - pure or deposited on an ironrich amorphous mineral phase - were exposed to solar UV, under a filter selected to simulate UV spectrum reaching the surface of the Red Planet. Measurements showed that all exposed samples were partially degraded, and quantum efficiencies of photodecomposition were calculated in the 200-250 nm wavelength range. None of the tested organics are stable under low Earth orbit solar UV radiation conditions. Interestingly, the presence of an iron-rich mineral phase increases their degradation.

Coussot et al. (2019 - Reference Documents no. 22 and 23) report on studies aimed to test whether spaceflight conditions might have influences on the performances of antibodies or aptamer-based biochips for future space instrumentation. Such innovative analytical instruments are under development to detect signatures of present or past life on planetary bodies. They are based on high affinity and specificity molecular recognition to detect target compounds at subnanomolar concentrations. The results presented suggest that cosmic radiation has no significant effect on the aptamers or antibodies recognition ability. However, repeated temperature cycling seems to alter the mobility of its fluorescein dye for aptamers, which could be interpreted as a loss of recognition, as the absence of the target, or as an alteration of the fluorescent dye properties.

EXPECTED RESULTS
The results from P.S.S. will provide data about the degradation of organic molecules when exposed for a prolonged period of time to solar UV. These results are expected to be significantly more reliable that the ground-based results obtained so far under simulated test conditions. The expected accuracy of the results is mandatory for a good understanding of chemical evolution in astrophysical environments rich in organic matter and of exo/astrobiological relevance (comets, meteorites, Titan, interstellar medium) or where organic matter is looked for (Martian surface and subsurface).
For the Biochips, exposure to energetic particles will reveal the resistance of antibodies and aptamers to space constraints. Recognition capabilities will be compared to lab references and ground controls. The scientific objectives are:
 (1) To test the validity of biochip to several space constraints,
 (2) If necessary, find the protection required to protect a biochip-based instrument.
[1]  
G.A. Baratta, G. Leto, M.E. Palumbo, (2002), "A comparison of ion irradiation and UV photolysis of CH4 and CH3OH", Astronomy & Astrophysics, 384, 1, pp. 343-349.
[2]  
B. Barbier, A. Chabin, D. Chaput, A. Brack, (1998), "Photochemical processing of amino acids in Earth orbit", Planetary and Space Science, 46, pp. 391-398.
[3]  
B. Barbier, O. Henin, F. Boillot, A. Chabin, D. Chaput, A. Brack, (2002), "Exposure of amino acids and derivatives in the Earth orbit", Planetary and Space Science, 50, pp. 353-359.
[4]  
F. Boillot, A. Chabin, C. Buré, M. Venet, A. Belsky, M. Bertrand-Urbaniak, A. Delmas, A. Brack, B. Barbier, (2002), "The Perseus Exobiology Mission on MIR: Behaviour of Amino Acids and Peptides in Earth Orbit", Origins of Life, 32, pp. 359-385.
[5]  
J.R. Brucato, G. Strazzulla, G. Baratta, L. Colangeli, (2004), "Forsterite amorphisation by ion irradiation: Monitoring by infrared spectroscopy", Astronomy & Astrophysics, 413, pp. 395-401.
[6]  
H. Cottin, Y. Bénilan, M.C. Gazeau, F. Raulin, (2004), "Origin of cometary extended sources from degradation of refractory organics on grains: polyoxymethylene as formaldehyde parent molecule", Icarus, 167, pp. 397-416.
[7]  
H. Cottin, P. Coll, D. Coscia, N. Fray, Y.Y. Guan, F. Macari, F. Raulin, C. Rivron, F. Stalport, C. Szopa, D. Chaput, M. Viso, M. Bertrand, A. Chabin, L. Thirkell, F. Westall, A. Brack, (2008), "Heterogeneous solid/gas chemistry of organic compounds related to comets, meteorites, Titan and Mars: in laboratory and in lower Earth orbit experiments", Advances in Space Research, 42, pp. 2019-2035.
[8]  
H. Cottin, Y.Y. Guan, A. Noblet, O. Poch, K. Saiagh, M. Cloix, F. Macari, M. Jérome, P. Coll, F. Raulin, F. Stalport, C. Szopa, M. Bertrand, A. Chabin, F. Westall, D. Chaput, R. Demets, A. Brack, (2012), "The PROCESS Experiment: An Astrochemistry Laboratory for Solid and Gaseous Organic Samples in Low‐Earth Orbit", Astrobiology, 12, 5, DOI: 10.1089/ast.2011.0773, pp. 421-425.
[9]  
M. Bertrand, A. Chabin, A. Brack, H. Cottin, D. Chaput, F. Westall, (2012), "The PROCESS Experiment: Exposure of Amino Acids in the EXPOSE‐E Experiment on the International Space Station and in Laboratory Simulations", Astrobiology, 12, 5, DOI: 10.1089/ast.2011.0755, pp. 426-435.
[10]  
A. Noblet, F. Stalport, Y.Y. Guan, O. Poch, P. Coll, C. Szopa, M. Cloix, F. Macari, F. Raulin, D. Chaput, H. Cottin, (2012), "The PROCESS experiment - Amino and Carboxylic Acids Under Mars-Like Surface UV Radiation Conditions in Low-Earth Orbit", Astrobiology, 12, 5, DOI: 10.1089/ast.2011.0756, pp. 436-444.
[11]  
P. Ehrenfreund, R. Ruiterkamp, Z. Peeters, B. Foing, F. Salama, Z. Martins, (2007), "The ORGANICS experiment on BIOPAN V: UV and space exposure of aromatic compounds", Planetary and Space Science, 55, pp. 383-400.
[12]  
Y.Y. Guan, N. Fray, P. Coll, F. Macari, F. Raulin, D. Chaput, H. Cottin, (2010), "Uvolution: Compared photochemistry of prebiotic organic compounds in low earth orbit and in the laboratory", Planetary and Space Science, 58, 10, DOI: 10.1016/j.pss.2010.05.017, pp. 1327-1346.
[13]  
A. Le Postollec, S. Incerti, M. Dobrijevic, L. Desorgher, G. Santin, P. Moretto, O. Vandenabeele-Trambouze, G. Coussot, L. Dartnell, P. Nieminen, (2009), "Monte Carlo Simulation of the Radiation Environment Encountered by a Biochip During a Space Mission to Mars", Astrobiology, 9, pp. 311-323.
[14]  
M.E. Palumbo, G. Ferini, G.A. Baratta, (2004), "Infrared and Raman spectroscopy of refractory residues left over after ion irradiation of nitrogen bearing icy mixtures", Advances in Space Research, 33, pp. 49-56.
[15]  
M.E. Palumbo, G. Strazzulla, Y.J. Pendleton, A.G.G.M. Tielens, (2000), "ROCN Species Produced by Ion Irradiation of Ice Mixtures: Comparison with Astronomical Observations", The Astrophysical Journal, 534, pp. 801-808.
[16]  
F. Stalport, P. Coll, C. Szopa, H. Cottin, F. Raulin, (2009), "Investigating the Photostability of Carboxylic Acids Exposed to Mars Surface Ultraviolet Radiation Conditions", Astrobiology, 9, pp. 543-549.
[17]  
F. Stalport, Y.Y. Guan, P. Coll, C. Szopa, F. Macari, F. Raulin, D. Chaput, H. Cottin, (2010), "UVolution, a Photochemistry Experiment in Low Earth Orbit: Investigation of the Photostability of Carboxylic Acids Exposed to Mars Surface UV Radiation Conditions", Astrobiology, 10, 4, DOI: 10.1089/ast.2009.0413, pp. 449-461.
[18]  
I.L. Ten Kate, J.R.C. Garry, Z. Peeters, R. Quinn, B. Foing, P. Ehrenfreund, (2005), "Amino acid photostability on the Martian surface", Meteoritics and Planetary Science, 40, pp. 1185.
[19]  
O. Vandenabeele-Trambouze, M. Geffard, D. Bodet, D. Despois, M. Dobrijevic, M.F. Grenier Loustalot, A. Commeyras, (2002), "Antibodies directed against L and D isovaline using a chemical derivatizing reagent for the measurement of their enantiomeric ratio in extraterrestrial samples: First step-production and characterization of antibodies", Chirality, 14, pp. 519-526.
[20]  
H. Cottin, P. Rettberg, (2019), "EXPOSE-R2 on the International Space Station (2014–2016): Results from the PSS and BOSS Astrobiology Experiments", Astrobiology, 19, 8, DOI: 10.1089/ast.2019.0625, pp. 975-978.
[21]  
G.A. Baratta, M. Accolla, D. Chaput, H. Cottin, M.E. Palumbo, G. Strazzulla, (2019), "Photolysis of Cometary Organic Dust Analogs on the EXPOSE-R2 Mission at the International Space Station", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.1853, pp. 1018-1036.
[22]  
G. Coussot, A. Le Postollec, C. Faye, M. Baqué, O. Vandenabeele-Trambouze, S. Incerti, F. Vigier, D. Chaput, H. Cottin, B. Przybyla, T. Berger, M. Dobrijevic, (2019), "Photochemistry on the Space Station - Antibody Resistance to Space Conditions after Exposure Outside the International Space Station", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.1907, pp. 1053-1062.
[23]  
G. Coussot, A. Le Postollec, S. Incerti, M. Baqué, C. Faye, O. Vandenabeele-Trambouze, H. Cottin, C. Ravelet, E. Peyrin, E. Fiore, F. Vigier, J. Caron, D. Chaput, B. Przybyla, T. Berger, M. Dobrijevic, (2019), "Photochemistry on the Space Station - Aptamer Resistance to Space Conditions: Particles Exposure from Irradiation Facilities and Real Exposure Outside the International Space Station", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.1896, pp. 1063-1074.
[24]  
F. Stalport, L. Rouquette, O. Poch, T. Dequaire, N. Chaouche-Mechidal, S. Payart, C. Szopa, P. Coll, D. Chaput, M. Jaber, F. Raulin, H. Cottin, (2019), "The Photochemistry on Space Station (PSS) Experiment: Organic Matter under Mars-like Surface UV Radiation Conditions in Low Earth Orbit", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.2001, pp. 1037-1052.
[25]  
E. Rabbow, P. Rettberg, A. Parpart, C. Panitz, W. Schulte, F. Molter, E. Jaramillo, R. Demets, P. Weiß, R. Willnecker, (2017), "EXPOSE-R2: The Astrobiological ESA Mission on Board of the International Space Station", Frontiers in Microbiology, 8, DOI: 10.3389/fmicb.2017.01533, pp. 1533.
click on items to display

Figure 1: Preliminary experiment lay-out based on the information from Table 1. The twelve carriers have been grouped in three sets of four, with each quartet occupying one EXPOSE tray. The configuration of P.S.S. (25 sample positions per carrier) is based on a preliminary concept from the PD.

Table 1: Overview of the sample carrier requirements

Table 2: Detailed Experiment Timeline and associated Functional Objectives

Figure 2: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 3: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 4: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 5: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 6: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 7: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 8: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 9: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.

Figure 10: The photo shows close-up views of EXPOSE-R2 taken during the Russian EVA-40 on 22 October 2014.
http://www.esa.int/Our_Ac
tivities/Human_Spacefligh
t/Principia/Russian_space
walk_marks_end_of_ESA_s_e
xposed_space_chemistry
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID56e96a702a15b.pd
f

Russian spacewalk to return Expose facility - Link to article on Tim Peake´s Principia blog: http://blogs.esa.int/tim-peake/2016/02/02/russian-spacewalk-to-return-expose-facility/

link to article on the ESA website: Russian spacewalk marks end of ESA´s exposed space chemistry (03 February 2016)

The worst trip around the world - ESA web article from 22 December 2014
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID56e96a7e99500.pd
f
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID56e96a8908e04.pd
f
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID5d556ee7dddc1.pd
f

Space Kombucha in the search for life and its origin - ESA web article from 29 July 2015

Russian spacewalk marks end of ESA’s exposed space chemistry - ESA web article from 03 February 2016

H. Cottin, P. Rettberg, (2019), "EXPOSE-R2 on the International Space Station (2014–2016): Results from the PSS and BOSS Astrobiology Experiments", Astrobiology, 19, 8, DOI: 10.1089/ast.2019.0625, pp. 975-978.
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID5d556efecedd6.pd
f
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID5d556f1030d12.pd
f
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID5d556f218a1b6.pd
f

G.A. Baratta, M. Accolla, D. Chaput, H. Cottin, M.E. Palumbo, G. Strazzulla, (2019), "Photolysis of Cometary Organic Dust Analogs on the EXPOSE-R2 Mission at the International Space Station", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.1853, pp. 1018-1036.

G. Coussot, A. Le Postollec, C. Faye, M. Baqué, O. Vandenabeele-Trambouze, S. Incerti, F. Vigier, D. Chaput, H. Cottin, B. Przybyla, T. Berger, M. Dobrijevic, (2019), "Photochemistry on the Space Station - Antibody Resistance to Space Conditions after Exposure Outside the International Space Station", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.1907, pp. 1053-1062.

G. Coussot, A. Le Postollec, S. Incerti, M. Baqué, C. Faye, O. Vandenabeele-Trambouze, H. Cottin, C. Ravelet, E. Peyrin, E. Fiore, F. Vigier, J. Caron, D. Chaput, B. Przybyla, T. Berger, M. Dobrijevic, (2019), "Photochemistry on the Space Station - Aptamer Resistance to Space Conditions: Particles Exposure from Irradiation Facilities and Real Exposure Outside the International Space Station", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.1896, pp. 1063-1074.
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID5d556f301e6d6.pd
f
http://eea.spaceflight.es
a.int/attachments/spacest
ations/ID5d80a06a571b3.pd
f

F. Stalport, L. Rouquette, O. Poch, T. Dequaire, N. Chaouche-Mechidal, S. Payart, C. Szopa, P. Coll, D. Chaput, M. Jaber, F. Raulin, H. Cottin, (2019), "The Photochemistry on Space Station (PSS) Experiment: Organic Matter under Mars-like Surface UV Radiation Conditions in Low Earth Orbit", Astrobiology, 19, 8, DOI: 10.1089/ast.2018.2001, pp. 1037-1052.

Rabbow, E., Rettberg, P., Parpart, A., Panitz, C., Schulte, W., Molter, F., Jaramillo, E., Demets, R., Weiß, P., Willnecker, R., (2017), "EXPOSE-R2: The Astrobiological ESA Mission on Board of the International Space Station", Frontiers in Microbiology, 8, DOI: 10.3389/fmicb.2017.01533, pp. 1533.
 
© 2020 European Space Agency